Implement simple Streamlit app for DNA insertion site analysis

[Copilot]

This PR implements a complete Streamlit web application for finding and checking DNA insertion sites using PyDNA and BioPython, addressing the requirement for "a simple streamlit app".

Features

🧬 DNA Sequence Analysis: Users can input DNA sequences either by typing/pasting directly or uploading FASTA files

⚗️ Restriction Enzyme Mapping: Interactive selection of common restriction enzymes (EcoRI, BamHI, HindIII, XhoI, NotI, SalI, KpnI, XbaI) to find cutting sites

📊 Sequence Statistics: Real-time calculation and display of sequence length, GC content, and molecular weight

🔍 Insertion Site Detection: Identifies potential cloning insertion points with detailed position information

📈 Interactive Results: Results displayed in sortable, exportable tables with comprehensive analysis summaries

Implementation Details

The app is built with:

• Streamlit for the web interface
• PyDNA for DNA sequence manipulation and analysis
• BioPython for restriction enzyme recognition and cutting
• Pandas for data presentation and export functionality

Key components:

• app.py: Main Streamlit application with modular analysis functions
• requirements.txt: All necessary dependencies pinned to stable versions
• Updated README.md with comprehensive usage instructions and examples

Testing

The application has been thoroughly tested with sample DNA sequences containing known restriction sites:

ATCGATCGATCGGAATTCGATCGATCGGATCCATCGATCGAAGCTTGATCGATCG

Successfully identifies:

• EcoRI site (GAATTC) at position 14
• BamHI site (GGATCC) at position 28
• Correct sequence statistics (55 bp, 49.1% GC content)

The app includes built-in help documentation and robust error handling for invalid sequences and edge cases.

Usage

pip install -r requirements.txt
streamlit run app.py

Perfect for molecular biology hackathons, cloning experiment planning, and educational purposes.

Warning

Firewall rules blocked me from connecting to one or more addresses (expand for details)

I tried to connect to the following addresses, but was blocked by firewall rules:

• checkip.amazonaws.com
  • Triggering command: /usr/bin/python /home/REDACTED/.local/bin/streamlit run app.py --server.port 8501 --server.headless true (dns block)

If you need me to access, download, or install something from one of these locations, you can either:

• Configure Actions setup steps to set up my environment, which run before the firewall is enabled
• Add the appropriate URLs or hosts to the custom allowlist in this repository's Copilot coding agent settings (admins only)

---

✨ Let Copilot coding agent set things up for you — coding agent works faster and does higher quality work when set up for your repo.